Review



lenti map3k6 tap  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    Addgene inc lenti map3k6 tap
    Lenti Map3k6 Tap, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lenti-map3k6-tap/MAP3K6-TAP+(Plasmid+%2369727)/pmc11040592-83-1-16
    Average 92 stars, based on 3 article reviews
    lenti map3k6 tap - by Bioz Stars, 2026-09
    92/100 stars

    Images

    Related Articles

    Cloning:

    Article Title: Dynamic ADP-Ribosylome, Phosphoproteome, and Interactome in LPS-Activated Macrophages.
    Article Snippet: Subscriber access provided by UNIV OF NEW ENGLAND ARMIDALE is published by the American Chemical Society.. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society.. Copyright © American Chemical Society.

    Article Title: Dynamic ADP-Ribosylome, Phosphoproteome, and Interactome in LPS-Activated Macrophages
    Article Snippet: .. Cloning Lenti-MAP3K6-TAP was generated by amplifying the coding amplicon from MAP3K6-TAP, a gift from Daniel Liebler (Addgene plasmid # 69727), with primers F:CGGGTTTGCCGCCAGAACACAGGACCGGTCGACTCACTATAGGGAGACCCAAGCTGG, R:CAGCAGAGAGAAGTTTGTTGCGCCGGATCCGGTGCTATCCAGGCCCAGCAGC followed by Gibson assembly into pLenti Mod1.1 EF1a-BFP 2A Blast where the BFP cassette was removed by Age I Bam HI. ..

    Generated:

    Article Title: Dynamic ADP-Ribosylome, Phosphoproteome, and Interactome in LPS-Activated Macrophages.
    Article Snippet: Subscriber access provided by UNIV OF NEW ENGLAND ARMIDALE is published by the American Chemical Society.. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society.. Copyright © American Chemical Society.

    Article Title: Dynamic ADP-Ribosylome, Phosphoproteome, and Interactome in LPS-Activated Macrophages
    Article Snippet: .. Cloning Lenti-MAP3K6-TAP was generated by amplifying the coding amplicon from MAP3K6-TAP, a gift from Daniel Liebler (Addgene plasmid # 69727), with primers F:CGGGTTTGCCGCCAGAACACAGGACCGGTCGACTCACTATAGGGAGACCCAAGCTGG, R:CAGCAGAGAGAAGTTTGTTGCGCCGGATCCGGTGCTATCCAGGCCCAGCAGC followed by Gibson assembly into pLenti Mod1.1 EF1a-BFP 2A Blast where the BFP cassette was removed by Age I Bam HI. ..

    Article Title: Dynamic ADP-Ribosylome, Phosphoproteome, and Interactome in LPS-Activated Macrophages
    Article Snippet: .. Lenti-MAP3K6-TAP was generated by amplifying the coding amplicon from MAP3K6-TAP, a gift from Daniel Liebler (Addgene plasmid # 69727), with primers F:CGGGTTTGCCGCCAGAACACAGGACCGGTCGACTCACTATAGGGAGACCCAAGCTGG, R:CAGCAGAGAGAAGTTTGTTGCGCCGGATCCGGTGCTATCCAGGCCCAGCAGC followed by Gibson assembly into pLenti Mod1.1 EF1a-BFP 2A Blast where the BFP cassette was removed by Age I Bam HI. ..

    Amplification:

    Article Title: Dynamic ADP-Ribosylome, Phosphoproteome, and Interactome in LPS-Activated Macrophages.
    Article Snippet: Subscriber access provided by UNIV OF NEW ENGLAND ARMIDALE is published by the American Chemical Society.. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society.. Copyright © American Chemical Society.

    Article Title: Dynamic ADP-Ribosylome, Phosphoproteome, and Interactome in LPS-Activated Macrophages
    Article Snippet: .. Cloning Lenti-MAP3K6-TAP was generated by amplifying the coding amplicon from MAP3K6-TAP, a gift from Daniel Liebler (Addgene plasmid # 69727), with primers F:CGGGTTTGCCGCCAGAACACAGGACCGGTCGACTCACTATAGGGAGACCCAAGCTGG, R:CAGCAGAGAGAAGTTTGTTGCGCCGGATCCGGTGCTATCCAGGCCCAGCAGC followed by Gibson assembly into pLenti Mod1.1 EF1a-BFP 2A Blast where the BFP cassette was removed by Age I Bam HI. ..

    Article Title: Dynamic ADP-Ribosylome, Phosphoproteome, and Interactome in LPS-Activated Macrophages
    Article Snippet: .. Lenti-MAP3K6-TAP was generated by amplifying the coding amplicon from MAP3K6-TAP, a gift from Daniel Liebler (Addgene plasmid # 69727), with primers F:CGGGTTTGCCGCCAGAACACAGGACCGGTCGACTCACTATAGGGAGACCCAAGCTGG, R:CAGCAGAGAGAAGTTTGTTGCGCCGGATCCGGTGCTATCCAGGCCCAGCAGC followed by Gibson assembly into pLenti Mod1.1 EF1a-BFP 2A Blast where the BFP cassette was removed by Age I Bam HI. ..

    Plasmid Preparation:

    Article Title: Dynamic ADP-Ribosylome, Phosphoproteome, and Interactome in LPS-Activated Macrophages.
    Article Snippet: Subscriber access provided by UNIV OF NEW ENGLAND ARMIDALE is published by the American Chemical Society.. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society.. Copyright © American Chemical Society.

    Article Title: Dynamic ADP-Ribosylome, Phosphoproteome, and Interactome in LPS-Activated Macrophages
    Article Snippet: .. Cloning Lenti-MAP3K6-TAP was generated by amplifying the coding amplicon from MAP3K6-TAP, a gift from Daniel Liebler (Addgene plasmid # 69727), with primers F:CGGGTTTGCCGCCAGAACACAGGACCGGTCGACTCACTATAGGGAGACCCAAGCTGG, R:CAGCAGAGAGAAGTTTGTTGCGCCGGATCCGGTGCTATCCAGGCCCAGCAGC followed by Gibson assembly into pLenti Mod1.1 EF1a-BFP 2A Blast where the BFP cassette was removed by Age I Bam HI. ..

    Article Title: Dynamic ADP-Ribosylome, Phosphoproteome, and Interactome in LPS-Activated Macrophages
    Article Snippet: .. Lenti-MAP3K6-TAP was generated by amplifying the coding amplicon from MAP3K6-TAP, a gift from Daniel Liebler (Addgene plasmid # 69727), with primers F:CGGGTTTGCCGCCAGAACACAGGACCGGTCGACTCACTATAGGGAGACCCAAGCTGG, R:CAGCAGAGAGAAGTTTGTTGCGCCGGATCCGGTGCTATCCAGGCCCAGCAGC followed by Gibson assembly into pLenti Mod1.1 EF1a-BFP 2A Blast where the BFP cassette was removed by Age I Bam HI. ..



    Similar Products

    92
    Addgene inc lenti map3k6 tap
    Lenti Map3k6 Tap, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lenti-map3k6-tap/MAP3K6-TAP+(Plasmid+%2369727)/pmc11040592-83-1-16
    Average 92 stars, based on 1 article reviews
    lenti map3k6 tap - by Bioz Stars, 2026-09
    92/100 stars
      Buy from Supplier

    92
    Addgene inc cloning lenti map3k6 tap
    Cloning Lenti Map3k6 Tap, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lenti-map3k6-tap/MAP3K6-TAP+(Plasmid+%2369727)/pm32529831-51-0-18
    Average 92 stars, based on 1 article reviews
    cloning lenti map3k6 tap - by Bioz Stars, 2026-09
    92/100 stars
      Buy from Supplier

    Image Search Results